ID: 964949592

View in Genome Browser
Species Human (GRCh38)
Location 3:162273503-162273525
Sequence AGTCTAAGTGGACAATAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964949589_964949592 0 Left 964949589 3:162273480-162273502 CCTTCAAATAGACCTTTAGAGAA No data
Right 964949592 3:162273503-162273525 AGTCTAAGTGGACAATAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964949592 Original CRISPR AGTCTAAGTGGACAATAAGC AGG Intergenic
No off target data available for this crispr