ID: 964952135

View in Genome Browser
Species Human (GRCh38)
Location 3:162308458-162308480
Sequence CAGTGTGAGGCCTGGGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964952129_964952135 28 Left 964952129 3:162308407-162308429 CCTGGCTGCTGAGACTGTGGGAG No data
Right 964952135 3:162308458-162308480 CAGTGTGAGGCCTGGGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964952135 Original CRISPR CAGTGTGAGGCCTGGGTTTA TGG Intergenic
No off target data available for this crispr