ID: 964955837

View in Genome Browser
Species Human (GRCh38)
Location 3:162354877-162354899
Sequence CTCCATATGGCATTTGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964955833_964955837 -6 Left 964955833 3:162354860-162354882 CCATACGTTTTGATATTCTCCAT No data
Right 964955837 3:162354877-162354899 CTCCATATGGCATTTGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964955837 Original CRISPR CTCCATATGGCATTTGGGTC AGG Intergenic
No off target data available for this crispr