ID: 964961041

View in Genome Browser
Species Human (GRCh38)
Location 3:162427289-162427311
Sequence CAGGTGTACTGCCAGTGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964961041_964961045 7 Left 964961041 3:162427289-162427311 CCAATCCACTGGCAGTACACCTG No data
Right 964961045 3:162427319-162427341 GAGAGAGAATCTGCGTGCTTAGG No data
964961041_964961047 9 Left 964961041 3:162427289-162427311 CCAATCCACTGGCAGTACACCTG No data
Right 964961047 3:162427321-162427343 GAGAGAATCTGCGTGCTTAGGGG No data
964961041_964961049 13 Left 964961041 3:162427289-162427311 CCAATCCACTGGCAGTACACCTG No data
Right 964961049 3:162427325-162427347 GAATCTGCGTGCTTAGGGGAGGG No data
964961041_964961048 12 Left 964961041 3:162427289-162427311 CCAATCCACTGGCAGTACACCTG No data
Right 964961048 3:162427324-162427346 AGAATCTGCGTGCTTAGGGGAGG No data
964961041_964961046 8 Left 964961041 3:162427289-162427311 CCAATCCACTGGCAGTACACCTG No data
Right 964961046 3:162427320-162427342 AGAGAGAATCTGCGTGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964961041 Original CRISPR CAGGTGTACTGCCAGTGGAT TGG (reversed) Intergenic
No off target data available for this crispr