ID: 964965980

View in Genome Browser
Species Human (GRCh38)
Location 3:162494590-162494612
Sequence CTAGTCCTGCCCTTGACACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2091
Summary {0: 2, 1: 52, 2: 285, 3: 599, 4: 1153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964965980_964965984 0 Left 964965980 3:162494590-162494612 CCACGTGTCAAGGGCAGGACTAG 0: 2
1: 52
2: 285
3: 599
4: 1153
Right 964965984 3:162494613-162494635 GTAGAAATAACTGAATCATGGGG No data
964965980_964965982 -2 Left 964965980 3:162494590-162494612 CCACGTGTCAAGGGCAGGACTAG 0: 2
1: 52
2: 285
3: 599
4: 1153
Right 964965982 3:162494611-162494633 AGGTAGAAATAACTGAATCATGG No data
964965980_964965983 -1 Left 964965980 3:162494590-162494612 CCACGTGTCAAGGGCAGGACTAG 0: 2
1: 52
2: 285
3: 599
4: 1153
Right 964965983 3:162494612-162494634 GGTAGAAATAACTGAATCATGGG No data
964965980_964965985 1 Left 964965980 3:162494590-162494612 CCACGTGTCAAGGGCAGGACTAG 0: 2
1: 52
2: 285
3: 599
4: 1153
Right 964965985 3:162494614-162494636 TAGAAATAACTGAATCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964965980 Original CRISPR CTAGTCCTGCCCTTGACACG TGG (reversed) Intergenic
Too many off-targets to display for this crispr