ID: 964973681

View in Genome Browser
Species Human (GRCh38)
Location 3:162592396-162592418
Sequence CTTTTTATGCTGAAAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964973678_964973681 19 Left 964973678 3:162592354-162592376 CCATAAATAAAAATTAATATTGA No data
Right 964973681 3:162592396-162592418 CTTTTTATGCTGAAAATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964973681 Original CRISPR CTTTTTATGCTGAAAATTGT AGG Intergenic
No off target data available for this crispr