ID: 964975036

View in Genome Browser
Species Human (GRCh38)
Location 3:162607612-162607634
Sequence TTGAATACACAGATGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964975036_964975039 18 Left 964975036 3:162607612-162607634 CCTCTGTGCATCTGTGTATTCAA No data
Right 964975039 3:162607653-162607675 GAACATTAGTAATTAGATTCGGG No data
964975036_964975038 17 Left 964975036 3:162607612-162607634 CCTCTGTGCATCTGTGTATTCAA No data
Right 964975038 3:162607652-162607674 AGAACATTAGTAATTAGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964975036 Original CRISPR TTGAATACACAGATGCACAG AGG (reversed) Intergenic
No off target data available for this crispr