ID: 964985578

View in Genome Browser
Species Human (GRCh38)
Location 3:162733575-162733597
Sequence TGTACTCCCAGTACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964985575_964985578 -2 Left 964985575 3:162733554-162733576 CCAGGCACAGTGGCTCACACCTG 0: 5858
1: 25977
2: 70674
3: 125747
4: 139903
Right 964985578 3:162733575-162733597 TGTACTCCCAGTACTTCAGGAGG No data
964985574_964985578 7 Left 964985574 3:162733545-162733567 CCACTGAAACCAGGCACAGTGGC No data
Right 964985578 3:162733575-162733597 TGTACTCCCAGTACTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964985578 Original CRISPR TGTACTCCCAGTACTTCAGG AGG Intergenic
No off target data available for this crispr