ID: 964990499

View in Genome Browser
Species Human (GRCh38)
Location 3:162805081-162805103
Sequence GTATCTGATGCCAATCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964990499_964990503 21 Left 964990499 3:162805081-162805103 CCCTCTAGATTGGCATCAGATAC No data
Right 964990503 3:162805125-162805147 TACCAGTGTATAGTTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964990499 Original CRISPR GTATCTGATGCCAATCTAGA GGG (reversed) Intergenic
No off target data available for this crispr