ID: 964991074

View in Genome Browser
Species Human (GRCh38)
Location 3:162813473-162813495
Sequence GTCCAATTTCAGACCGGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964991068_964991074 30 Left 964991068 3:162813420-162813442 CCCTTTTATCTTTAATCCATCTT No data
Right 964991074 3:162813473-162813495 GTCCAATTTCAGACCGGCCACGG No data
964991070_964991074 14 Left 964991070 3:162813436-162813458 CCATCTTGAGTTATTTTTTATAT No data
Right 964991074 3:162813473-162813495 GTCCAATTTCAGACCGGCCACGG No data
964991069_964991074 29 Left 964991069 3:162813421-162813443 CCTTTTATCTTTAATCCATCTTG No data
Right 964991074 3:162813473-162813495 GTCCAATTTCAGACCGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964991074 Original CRISPR GTCCAATTTCAGACCGGCCA CGG Intergenic
No off target data available for this crispr