ID: 965009817

View in Genome Browser
Species Human (GRCh38)
Location 3:163073379-163073401
Sequence CAGTGATGGCCTGAAGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965009808_965009817 -2 Left 965009808 3:163073358-163073380 CCCAGTGAATCCCCTTTAGGCCA No data
Right 965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG No data
965009805_965009817 20 Left 965009805 3:163073336-163073358 CCTAGGCAGGAAAGGGTGTGTCC No data
Right 965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG No data
965009807_965009817 -1 Left 965009807 3:163073357-163073379 CCCCAGTGAATCCCCTTTAGGCC No data
Right 965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG No data
965009809_965009817 -3 Left 965009809 3:163073359-163073381 CCAGTGAATCCCCTTTAGGCCAG No data
Right 965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965009817 Original CRISPR CAGTGATGGCCTGAAGCATG GGG Intergenic
No off target data available for this crispr