ID: 965010335

View in Genome Browser
Species Human (GRCh38)
Location 3:163079978-163080000
Sequence CGTGATCCTGAATAACTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965010333_965010335 4 Left 965010333 3:163079951-163079973 CCACACAACGGCATGTAAACTGA No data
Right 965010335 3:163079978-163080000 CGTGATCCTGAATAACTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965010335 Original CRISPR CGTGATCCTGAATAACTACT GGG Intergenic
No off target data available for this crispr