ID: 965012775

View in Genome Browser
Species Human (GRCh38)
Location 3:163116541-163116563
Sequence GTGGACTGCCTTGTAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965012775_965012778 15 Left 965012775 3:163116541-163116563 CCAGTGTTTACAAGGCAGTCCAC No data
Right 965012778 3:163116579-163116601 ATAGTTATTCATAAAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965012775 Original CRISPR GTGGACTGCCTTGTAAACAC TGG (reversed) Intergenic
No off target data available for this crispr