ID: 965013160

View in Genome Browser
Species Human (GRCh38)
Location 3:163123532-163123554
Sequence CTACATAAGCAGAAGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965013160_965013164 19 Left 965013160 3:163123532-163123554 CCCTTTTCCTTCTGCTTATGTAG No data
Right 965013164 3:163123574-163123596 TTCAGCCTTGCTGACATTTCTGG No data
965013160_965013165 20 Left 965013160 3:163123532-163123554 CCCTTTTCCTTCTGCTTATGTAG No data
Right 965013165 3:163123575-163123597 TCAGCCTTGCTGACATTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965013160 Original CRISPR CTACATAAGCAGAAGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr