ID: 965017191

View in Genome Browser
Species Human (GRCh38)
Location 3:163173246-163173268
Sequence CGAGTTGGAAAACACTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10759
Summary {0: 12, 1: 1240, 2: 6206, 3: 2362, 4: 939}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965017191_965017193 3 Left 965017191 3:163173246-163173268 CCTGAAGAGTGTTTTCCAACTCG 0: 12
1: 1240
2: 6206
3: 2362
4: 939
Right 965017193 3:163173272-163173294 CTATTCTCCCTTTCACTTTCAGG No data
965017191_965017196 22 Left 965017191 3:163173246-163173268 CCTGAAGAGTGTTTTCCAACTCG 0: 12
1: 1240
2: 6206
3: 2362
4: 939
Right 965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965017191 Original CRISPR CGAGTTGGAAAACACTCTTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr