ID: 965017192

View in Genome Browser
Species Human (GRCh38)
Location 3:163173261-163173283
Sequence AAGGGAGAATAGAAGCGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965017192_965017196 7 Left 965017192 3:163173261-163173283 CCAACTCGCTTCTATTCTCCCTT No data
Right 965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965017192 Original CRISPR AAGGGAGAATAGAAGCGAGT TGG (reversed) Intergenic
No off target data available for this crispr