ID: 965017196

View in Genome Browser
Species Human (GRCh38)
Location 3:163173291-163173313
Sequence CAGGTACACCAATTAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965017192_965017196 7 Left 965017192 3:163173261-163173283 CCAACTCGCTTCTATTCTCCCTT No data
Right 965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG No data
965017191_965017196 22 Left 965017191 3:163173246-163173268 CCTGAAGAGTGTTTTCCAACTCG 0: 12
1: 1240
2: 6206
3: 2362
4: 939
Right 965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965017196 Original CRISPR CAGGTACACCAATTAAATGT AGG Intergenic
No off target data available for this crispr