ID: 965024075

View in Genome Browser
Species Human (GRCh38)
Location 3:163275911-163275933
Sequence TTAACAACATAGGAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965024075_965024078 2 Left 965024075 3:163275911-163275933 CCTACCAACTCCTATGTTGTTAA No data
Right 965024078 3:163275936-163275958 AAAAACTGAATAATAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965024075 Original CRISPR TTAACAACATAGGAGTTGGT AGG (reversed) Intergenic
No off target data available for this crispr