ID: 965027096

View in Genome Browser
Species Human (GRCh38)
Location 3:163316168-163316190
Sequence AGTGAGAGCAAAGTGATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965027096_965027102 25 Left 965027096 3:163316168-163316190 CCTCCAATCACTTTGCTCTCACT No data
Right 965027102 3:163316216-163316238 CATGCCACACAGCATTGACAGGG No data
965027096_965027101 24 Left 965027096 3:163316168-163316190 CCTCCAATCACTTTGCTCTCACT No data
Right 965027101 3:163316215-163316237 CCATGCCACACAGCATTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965027096 Original CRISPR AGTGAGAGCAAAGTGATTGG AGG (reversed) Intergenic
No off target data available for this crispr