ID: 965028869

View in Genome Browser
Species Human (GRCh38)
Location 3:163337071-163337093
Sequence AGTGATATTCAGAAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965028869_965028875 14 Left 965028869 3:163337071-163337093 CCAGCCTTCTTCTGAATATCACT No data
Right 965028875 3:163337108-163337130 CATAAAAATGGCTTTAAGCTGGG No data
965028869_965028878 21 Left 965028869 3:163337071-163337093 CCAGCCTTCTTCTGAATATCACT No data
Right 965028878 3:163337115-163337137 ATGGCTTTAAGCTGGGCATGGGG No data
965028869_965028877 20 Left 965028869 3:163337071-163337093 CCAGCCTTCTTCTGAATATCACT No data
Right 965028877 3:163337114-163337136 AATGGCTTTAAGCTGGGCATGGG No data
965028869_965028871 2 Left 965028869 3:163337071-163337093 CCAGCCTTCTTCTGAATATCACT No data
Right 965028871 3:163337096-163337118 CAGCCTGAAGACCATAAAAATGG No data
965028869_965028876 19 Left 965028869 3:163337071-163337093 CCAGCCTTCTTCTGAATATCACT No data
Right 965028876 3:163337113-163337135 AAATGGCTTTAAGCTGGGCATGG No data
965028869_965028874 13 Left 965028869 3:163337071-163337093 CCAGCCTTCTTCTGAATATCACT No data
Right 965028874 3:163337107-163337129 CCATAAAAATGGCTTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965028869 Original CRISPR AGTGATATTCAGAAGAAGGC TGG (reversed) Intergenic
No off target data available for this crispr