ID: 965032831

View in Genome Browser
Species Human (GRCh38)
Location 3:163395494-163395516
Sequence ACTTTCTATGTGTAGTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965032831_965032833 -1 Left 965032831 3:163395494-163395516 CCCAAAAACTACACATAGAAAGT No data
Right 965032833 3:163395516-163395538 TACAAACCCCAAAATAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965032831 Original CRISPR ACTTTCTATGTGTAGTTTTT GGG (reversed) Intergenic
No off target data available for this crispr