ID: 965032832

View in Genome Browser
Species Human (GRCh38)
Location 3:163395495-163395517
Sequence TACTTTCTATGTGTAGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965032832_965032833 -2 Left 965032832 3:163395495-163395517 CCAAAAACTACACATAGAAAGTA No data
Right 965032833 3:163395516-163395538 TACAAACCCCAAAATAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965032832 Original CRISPR TACTTTCTATGTGTAGTTTT TGG (reversed) Intergenic
No off target data available for this crispr