ID: 965032833

View in Genome Browser
Species Human (GRCh38)
Location 3:163395516-163395538
Sequence TACAAACCCCAAAATAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965032832_965032833 -2 Left 965032832 3:163395495-163395517 CCAAAAACTACACATAGAAAGTA No data
Right 965032833 3:163395516-163395538 TACAAACCCCAAAATAATCAAGG No data
965032831_965032833 -1 Left 965032831 3:163395494-163395516 CCCAAAAACTACACATAGAAAGT No data
Right 965032833 3:163395516-163395538 TACAAACCCCAAAATAATCAAGG No data
965032830_965032833 0 Left 965032830 3:163395493-163395515 CCCCAAAAACTACACATAGAAAG No data
Right 965032833 3:163395516-163395538 TACAAACCCCAAAATAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965032833 Original CRISPR TACAAACCCCAAAATAATCA AGG Intergenic
No off target data available for this crispr