ID: 965038721

View in Genome Browser
Species Human (GRCh38)
Location 3:163478558-163478580
Sequence GTGATACATAGGCCCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965038716_965038721 15 Left 965038716 3:163478520-163478542 CCGAAGGAAGGAAAGAAGCACTT No data
Right 965038721 3:163478558-163478580 GTGATACATAGGCCCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965038721 Original CRISPR GTGATACATAGGCCCACTGA AGG Intergenic
No off target data available for this crispr