ID: 965041098

View in Genome Browser
Species Human (GRCh38)
Location 3:163507985-163508007
Sequence CTGGAGAAACAGGTGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965041089_965041098 8 Left 965041089 3:163507954-163507976 CCATATTTCCATTTATTCACCAG No data
Right 965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG No data
965041090_965041098 0 Left 965041090 3:163507962-163507984 CCATTTATTCACCAGTCTGCCTT No data
Right 965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965041098 Original CRISPR CTGGAGAAACAGGTGGGTCT GGG Intergenic
No off target data available for this crispr