ID: 965042286

View in Genome Browser
Species Human (GRCh38)
Location 3:163524902-163524924
Sequence CAATATCAATTTAACAAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965042286_965042289 11 Left 965042286 3:163524902-163524924 CCCCGTTTGTTAAATTGATATTG No data
Right 965042289 3:163524936-163524958 AATTGACACAGACATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965042286 Original CRISPR CAATATCAATTTAACAAACG GGG (reversed) Intergenic
No off target data available for this crispr