ID: 965042286 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:163524902-163524924 |
| Sequence | CAATATCAATTTAACAAACG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 965042286_965042289 | 11 | Left | 965042286 | 3:163524902-163524924 | CCCCGTTTGTTAAATTGATATTG | No data | ||
| Right | 965042289 | 3:163524936-163524958 | AATTGACACAGACATATTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 965042286 | Original CRISPR | CAATATCAATTTAACAAACG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||