ID: 965044418

View in Genome Browser
Species Human (GRCh38)
Location 3:163557352-163557374
Sequence TAGTGTCTTCAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965044418_965044424 15 Left 965044418 3:163557352-163557374 CCATGCTCCATCTGAAGACACTA No data
Right 965044424 3:163557390-163557412 CAGAACTCTGCCCCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965044418 Original CRISPR TAGTGTCTTCAGATGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr