ID: 965058340

View in Genome Browser
Species Human (GRCh38)
Location 3:163750003-163750025
Sequence GGGGTGGTTGCACTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965058340_965058349 9 Left 965058340 3:163750003-163750025 CCCCAGCACAGTGCAACCACCCC No data
Right 965058349 3:163750035-163750057 GGCCAGATTGTTTTCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965058340 Original CRISPR GGGGTGGTTGCACTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr