ID: 965062672

View in Genome Browser
Species Human (GRCh38)
Location 3:163803632-163803654
Sequence CTGTAGGAAGGCTAGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965062672_965062683 28 Left 965062672 3:163803632-163803654 CCCATATCCTAGCCTTCCTACAG No data
Right 965062683 3:163803683-163803705 TCTAATCTCCCCTACCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965062672 Original CRISPR CTGTAGGAAGGCTAGGATAT GGG (reversed) Intergenic
No off target data available for this crispr