ID: 965066284

View in Genome Browser
Species Human (GRCh38)
Location 3:163854680-163854702
Sequence CTGGGTGGACAAGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965066275_965066284 20 Left 965066275 3:163854637-163854659 CCCATCATGCTCAATAGGAAGCA No data
Right 965066284 3:163854680-163854702 CTGGGTGGACAAGTGGTGCATGG No data
965066274_965066284 21 Left 965066274 3:163854636-163854658 CCCCATCATGCTCAATAGGAAGC No data
Right 965066284 3:163854680-163854702 CTGGGTGGACAAGTGGTGCATGG No data
965066276_965066284 19 Left 965066276 3:163854638-163854660 CCATCATGCTCAATAGGAAGCAC No data
Right 965066284 3:163854680-163854702 CTGGGTGGACAAGTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965066284 Original CRISPR CTGGGTGGACAAGTGGTGCA TGG Intergenic
No off target data available for this crispr