ID: 965066497

View in Genome Browser
Species Human (GRCh38)
Location 3:163857024-163857046
Sequence TAAAAATCCCATAGTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965066497_965066507 16 Left 965066497 3:163857024-163857046 CCATGTCCACTATGGGATTTTTA No data
Right 965066507 3:163857063-163857085 AATCATGGGGAATTTAGGCAAGG No data
965066497_965066506 11 Left 965066497 3:163857024-163857046 CCATGTCCACTATGGGATTTTTA No data
Right 965066506 3:163857058-163857080 ACTATAATCATGGGGAATTTAGG No data
965066497_965066503 1 Left 965066497 3:163857024-163857046 CCATGTCCACTATGGGATTTTTA No data
Right 965066503 3:163857048-163857070 GGCAATGGGTACTATAATCATGG No data
965066497_965066505 3 Left 965066497 3:163857024-163857046 CCATGTCCACTATGGGATTTTTA No data
Right 965066505 3:163857050-163857072 CAATGGGTACTATAATCATGGGG No data
965066497_965066504 2 Left 965066497 3:163857024-163857046 CCATGTCCACTATGGGATTTTTA No data
Right 965066504 3:163857049-163857071 GCAATGGGTACTATAATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965066497 Original CRISPR TAAAAATCCCATAGTGGACA TGG (reversed) Intergenic
No off target data available for this crispr