ID: 965066593

View in Genome Browser
Species Human (GRCh38)
Location 3:163857884-163857906
Sequence GACAAGGAGGTGCCTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965066593_965066597 -3 Left 965066593 3:163857884-163857906 CCAGGTTCAGGCACCTCCTTGTC No data
Right 965066597 3:163857904-163857926 GTCTGTGCACCCTCAGGACATGG No data
965066593_965066603 30 Left 965066593 3:163857884-163857906 CCAGGTTCAGGCACCTCCTTGTC No data
Right 965066603 3:163857937-163857959 CCCAGCCACTTCAGCTCCAGTGG No data
965066593_965066595 -9 Left 965066593 3:163857884-163857906 CCAGGTTCAGGCACCTCCTTGTC No data
Right 965066595 3:163857898-163857920 CTCCTTGTCTGTGCACCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965066593 Original CRISPR GACAAGGAGGTGCCTGAACC TGG (reversed) Intergenic
No off target data available for this crispr