ID: 965066648

View in Genome Browser
Species Human (GRCh38)
Location 3:163858171-163858193
Sequence CTCTGTTAGGGCAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965066642_965066648 -9 Left 965066642 3:163858157-163858179 CCCTCATGGAGAACCTCTGTTAG 0: 46
1: 1151
2: 1534
3: 1216
4: 943
Right 965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG No data
965066643_965066648 -10 Left 965066643 3:163858158-163858180 CCTCATGGAGAACCTCTGTTAGG 0: 47
1: 1160
2: 1643
3: 1360
4: 980
Right 965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG No data
965066636_965066648 29 Left 965066636 3:163858119-163858141 CCTGGATGTACAAGCAGAAGTTG No data
Right 965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965066648 Original CRISPR CTCTGTTAGGGCAATGTGGA AGG Intergenic
No off target data available for this crispr