ID: 965067124

View in Genome Browser
Species Human (GRCh38)
Location 3:163864308-163864330
Sequence GGGAAGGTCATCTTCCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965067124_965067128 0 Left 965067124 3:163864308-163864330 CCTCAGGGGAAGATGACCTTCCC No data
Right 965067128 3:163864331-163864353 TCTCTGTCCCCTCATCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965067124 Original CRISPR GGGAAGGTCATCTTCCCCTG AGG (reversed) Intergenic
No off target data available for this crispr