ID: 965067128

View in Genome Browser
Species Human (GRCh38)
Location 3:163864331-163864353
Sequence TCTCTGTCCCCTCATCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965067124_965067128 0 Left 965067124 3:163864308-163864330 CCTCAGGGGAAGATGACCTTCCC No data
Right 965067128 3:163864331-163864353 TCTCTGTCCCCTCATCCTCCTGG No data
965067123_965067128 5 Left 965067123 3:163864303-163864325 CCAGACCTCAGGGGAAGATGACC No data
Right 965067128 3:163864331-163864353 TCTCTGTCCCCTCATCCTCCTGG No data
965067120_965067128 15 Left 965067120 3:163864293-163864315 CCAAGAACAGCCAGACCTCAGGG No data
Right 965067128 3:163864331-163864353 TCTCTGTCCCCTCATCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965067128 Original CRISPR TCTCTGTCCCCTCATCCTCC TGG Intergenic
No off target data available for this crispr