ID: 965082400

View in Genome Browser
Species Human (GRCh38)
Location 3:164051350-164051372
Sequence GCATTGATACCAGCTGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965082397_965082400 28 Left 965082397 3:164051299-164051321 CCAAACCAATCATCATAAAATTG No data
Right 965082400 3:164051350-164051372 GCATTGATACCAGCTGTCATTGG No data
965082398_965082400 23 Left 965082398 3:164051304-164051326 CCAATCATCATAAAATTGACATC No data
Right 965082400 3:164051350-164051372 GCATTGATACCAGCTGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965082400 Original CRISPR GCATTGATACCAGCTGTCAT TGG Intergenic
No off target data available for this crispr