ID: 965084587

View in Genome Browser
Species Human (GRCh38)
Location 3:164078588-164078610
Sequence CACCGTACTATCTCCCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965084587_965084589 9 Left 965084587 3:164078588-164078610 CCATTGTGGGAGATAGTACGGTG No data
Right 965084589 3:164078620-164078642 AGACCTAAAGACAGAACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965084587 Original CRISPR CACCGTACTATCTCCCACAA TGG (reversed) Intergenic