ID: 965085395

View in Genome Browser
Species Human (GRCh38)
Location 3:164089149-164089171
Sequence CACTGGACAGTTATTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965085395_965085398 30 Left 965085395 3:164089149-164089171 CCAGTTTCAATAACTGTCCAGTG No data
Right 965085398 3:164089202-164089224 ACCTTCATTTTTCAGACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965085395 Original CRISPR CACTGGACAGTTATTGAAAC TGG (reversed) Intergenic