ID: 965092101

View in Genome Browser
Species Human (GRCh38)
Location 3:164177749-164177771
Sequence CAATGTGCAAAACATGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965092101_965092103 14 Left 965092101 3:164177749-164177771 CCTGTAACATGTTTTGCACATTG No data
Right 965092103 3:164177786-164177808 ATAGACATACACTCCAGTACTGG No data
965092101_965092104 15 Left 965092101 3:164177749-164177771 CCTGTAACATGTTTTGCACATTG No data
Right 965092104 3:164177787-164177809 TAGACATACACTCCAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965092101 Original CRISPR CAATGTGCAAAACATGTTAC AGG (reversed) Intergenic