ID: 965092104

View in Genome Browser
Species Human (GRCh38)
Location 3:164177787-164177809
Sequence TAGACATACACTCCAGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965092101_965092104 15 Left 965092101 3:164177749-164177771 CCTGTAACATGTTTTGCACATTG No data
Right 965092104 3:164177787-164177809 TAGACATACACTCCAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965092104 Original CRISPR TAGACATACACTCCAGTACT GGG Intergenic