ID: 965093280

View in Genome Browser
Species Human (GRCh38)
Location 3:164189366-164189388
Sequence TAGGCAACCCATTTAATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965093278_965093280 8 Left 965093278 3:164189335-164189357 CCAGCTAAATGTGTACAGGTACT No data
Right 965093280 3:164189366-164189388 TAGGCAACCCATTTAATTGCAGG No data
965093276_965093280 16 Left 965093276 3:164189327-164189349 CCTTGAATCCAGCTAAATGTGTA No data
Right 965093280 3:164189366-164189388 TAGGCAACCCATTTAATTGCAGG No data
965093275_965093280 22 Left 965093275 3:164189321-164189343 CCAGCTCCTTGAATCCAGCTAAA No data
Right 965093280 3:164189366-164189388 TAGGCAACCCATTTAATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965093280 Original CRISPR TAGGCAACCCATTTAATTGC AGG Intergenic
No off target data available for this crispr