ID: 965094658

View in Genome Browser
Species Human (GRCh38)
Location 3:164209572-164209594
Sequence ATCATTCCTGTCTCAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965094654_965094658 6 Left 965094654 3:164209543-164209565 CCCAGCATGTTGTGTTTTCTTGC No data
Right 965094658 3:164209572-164209594 ATCATTCCTGTCTCAACCCATGG No data
965094655_965094658 5 Left 965094655 3:164209544-164209566 CCAGCATGTTGTGTTTTCTTGCC No data
Right 965094658 3:164209572-164209594 ATCATTCCTGTCTCAACCCATGG No data
965094653_965094658 22 Left 965094653 3:164209527-164209549 CCAGACACTCAGCTTTCCCAGCA No data
Right 965094658 3:164209572-164209594 ATCATTCCTGTCTCAACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965094658 Original CRISPR ATCATTCCTGTCTCAACCCA TGG Intergenic
No off target data available for this crispr