ID: 965095122

View in Genome Browser
Species Human (GRCh38)
Location 3:164216271-164216293
Sequence CCTGGATAGACCCCTACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965095122_965095129 18 Left 965095122 3:164216271-164216293 CCAGGAGTAGGGGTCTATCCAGG No data
Right 965095129 3:164216312-164216334 TCTTCCATATGGCTATTTGTTGG No data
965095122_965095125 7 Left 965095122 3:164216271-164216293 CCAGGAGTAGGGGTCTATCCAGG No data
Right 965095125 3:164216301-164216323 TCCTCCCACATTCTTCCATATGG No data
965095122_965095130 19 Left 965095122 3:164216271-164216293 CCAGGAGTAGGGGTCTATCCAGG No data
Right 965095130 3:164216313-164216335 CTTCCATATGGCTATTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965095122 Original CRISPR CCTGGATAGACCCCTACTCC TGG (reversed) Intergenic
No off target data available for this crispr