ID: 965104372

View in Genome Browser
Species Human (GRCh38)
Location 3:164339298-164339320
Sequence GAGTTAGGTGGCCCTCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965104372_965104378 28 Left 965104372 3:164339298-164339320 CCCTTAAGAGGGCCACCTAACTC No data
Right 965104378 3:164339349-164339371 TCCAGAGTTTGCCTTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965104372 Original CRISPR GAGTTAGGTGGCCCTCTTAA GGG (reversed) Intergenic
No off target data available for this crispr