ID: 965109706

View in Genome Browser
Species Human (GRCh38)
Location 3:164405004-164405026
Sequence AAGGACCTGCAATATGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965109706_965109710 12 Left 965109706 3:164405004-164405026 CCCTGATCATATTGCAGGTCCTT No data
Right 965109710 3:164405039-164405061 ATAATTGTTTATGGAGTAATTGG No data
965109706_965109709 3 Left 965109706 3:164405004-164405026 CCCTGATCATATTGCAGGTCCTT No data
Right 965109709 3:164405030-164405052 ATTATGCAGATAATTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965109706 Original CRISPR AAGGACCTGCAATATGATCA GGG (reversed) Intergenic
No off target data available for this crispr