ID: 965112786

View in Genome Browser
Species Human (GRCh38)
Location 3:164448849-164448871
Sequence AGCTGTACCCTGCAAGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965112782_965112786 27 Left 965112782 3:164448799-164448821 CCTGGAAAAGTCACAGGAACTCT No data
Right 965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG No data
965112784_965112786 -4 Left 965112784 3:164448830-164448852 CCATGAAAGCAGCTCCACAAGCT No data
Right 965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG No data
965112783_965112786 -3 Left 965112783 3:164448829-164448851 CCCATGAAAGCAGCTCCACAAGC No data
Right 965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965112786 Original CRISPR AGCTGTACCCTGCAAGCTGC AGG Intergenic
No off target data available for this crispr