ID: 965113810

View in Genome Browser
Species Human (GRCh38)
Location 3:164461354-164461376
Sequence ATATACTCCTTGGCAAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965113810_965113813 18 Left 965113810 3:164461354-164461376 CCAATGTTTGCCAAGGAGTATAT No data
Right 965113813 3:164461395-164461417 GCAGAACTCATTATTTTAAATGG No data
965113810_965113814 19 Left 965113810 3:164461354-164461376 CCAATGTTTGCCAAGGAGTATAT No data
Right 965113814 3:164461396-164461418 CAGAACTCATTATTTTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965113810 Original CRISPR ATATACTCCTTGGCAAACAT TGG (reversed) Intergenic
No off target data available for this crispr