ID: 965115494

View in Genome Browser
Species Human (GRCh38)
Location 3:164482868-164482890
Sequence TTCAGCAGTCCTGCGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965115491_965115494 11 Left 965115491 3:164482834-164482856 CCAGCATAGAGCTTCTCAGCTAT No data
Right 965115494 3:164482868-164482890 TTCAGCAGTCCTGCGTGCTGTGG No data
965115490_965115494 19 Left 965115490 3:164482826-164482848 CCAGCATTCCAGCATAGAGCTTC No data
Right 965115494 3:164482868-164482890 TTCAGCAGTCCTGCGTGCTGTGG No data
965115489_965115494 20 Left 965115489 3:164482825-164482847 CCCAGCATTCCAGCATAGAGCTT No data
Right 965115494 3:164482868-164482890 TTCAGCAGTCCTGCGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965115494 Original CRISPR TTCAGCAGTCCTGCGTGCTG TGG Intergenic
No off target data available for this crispr