ID: 965117593

View in Genome Browser
Species Human (GRCh38)
Location 3:164512225-164512247
Sequence GGGAAGACATGGAATTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965117593_965117598 22 Left 965117593 3:164512225-164512247 CCATTATAATTCCATGTCTTCCC No data
Right 965117598 3:164512270-164512292 AATATTATTATATGATTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965117593 Original CRISPR GGGAAGACATGGAATTATAA TGG (reversed) Intergenic
No off target data available for this crispr