ID: 965120681

View in Genome Browser
Species Human (GRCh38)
Location 3:164551481-164551503
Sequence GGGGTTAAACAGATGAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965120676_965120681 3 Left 965120676 3:164551455-164551477 CCAGGATAAACATTCCAAATAAT No data
Right 965120681 3:164551481-164551503 GGGGTTAAACAGATGAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965120681 Original CRISPR GGGGTTAAACAGATGAAGAG TGG Intergenic
No off target data available for this crispr